U.S. flag

An official website of the United States government

Format

Send to:

Choose Destination

SRX5625980: BSL2012.094_2012-08-07_BLE-LTER_KA2_Metagenome (> 3 m)_1 m
1 ILLUMINA (Illumina MiSeq) run: 24,167 spots, 7.3M bases, 3.7Mb downloads

Design: Eukaryote-specific PCR primers were used for amplification of the V9 region of 18S rRNA genes with forward primer 1391f and reverse primer EukBr according to Earth Microbiome Project Protocol. The forward primer was linked to Illumina adapter as follows: 5' Illumina adapter - Forward primer pad - 2bp linker - Forward primer, 1391F (1391F: AATGATACGGCGACCACCGAGATCTACAC TATCGCCGTT CG GTACACACCGCCCGTC). The reverse primer additionally included a unique 12 bp barcode as follows: Reverse complement of 3' Illumina adapter - 12 bp Golay barcode - Reverse primer pad - Reverse primer linker - Reverse primer, EukBr (EukBr: CAAGCAGAAGACGGCATACGAGAT XXXXXXXXXXXX AGTCAGTCAG CA TGATCCTTCTGCAGGTTCACCTAC)
Submitted by: Oregon State University
Study: Beaufort Lagoon Ecosystem Long Term Ecological Research (BLE-LTER) PCR Amplicon sequences
show Abstracthide Abstract
The Beaufort Lagoon Ecosystems (BLE) LTER program is based out of three nodes along the U.S. Beaufort Sea coast: Utqiagvik (formerly Barrow), Deadhorse, and Kaktovik. At each node, we deploy instruments and collect samples in nearby lagoon systems, each with their own unique characteristics. This research provides a much needed mechanism for tracking and understanding 1) how natural climate cycles influence coastal ecosystems in the Arctic, and 2) climate change effects such as permafrost thaw, shifting precipitation regimes, and losses of sea ice alter coastal ecosystems thorough effects on inputs, nutrient cycling, and ocean mixing.
Sample: BSL2012.094_2012-08-07_BLE-LTER_KA2_Metagenome (> 3 μm)_1 m
SAMN11293145 • SRS4567077 • All experiments • All runs
Library:
Name: BSL2012.094.OSUCGRB43
Instrument: Illumina MiSeq
Strategy: AMPLICON
Source: METAGENOMIC
Selection: PCR
Layout: PAIRED
Runs: 1 run, 24,167 spots, 7.3M bases, 3.7Mb
Run# of Spots# of BasesSizePublished
SRR883813524,1677.3M3.7Mb2019-12-18

ID:
7583712

Supplemental Content

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...